Review



lentiviral vector plko 1 shrna control shctrl  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc lentiviral vector plko 1 shrna control shctrl
    Lentiviral Vector Plko 1 Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 377 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+trc+lentiviral+shrna+system/pLKO%2E1+-+TRC+control+(Plasmid+%2310879)/pm41596422-229-0-6
    Average 96 stars, based on 377 article reviews
    lentiviral vector plko 1 shrna control shctrl - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control.
    Article Snippet: .. The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A: (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a: (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1: (GCTACTTTACTCCAACTTATT), human MFN1: (GCTCAAAGTTGTAAATGCTTT), and human MIRO2: (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid. ..

    Article Title: PTEN regulates RPA1 and protects DNA replication forks
    Article Snippet: pSA, pCMV-tag-2b, pGEX-4T-1 and pfastbac1 were purchased from Addgene. .. Wild-type and mutant PTEN and RPA1 were inserted into these plasmids. pLKO.1-TRC lentiviral shRNA system (Addgene) was used for PTEN and RPA1 knockdown. ..


    Article Title: Macrophage PD-1 regulates energy expenditure and metabolic dysfunction under immune checkpoint blockade.
    Article Snippet: In brief Wu et al. identified a moonlighting function of macrophage PD-1 in protecting against high-fat diet-induced obesity and the obesity-associated inflammatory microenvironment by suppressing ER stress-mediated systemic inflammatory responses.. Their findings highlight the critical role of macrophage PD-1 at the intersection of immune checkpoint blockade, energy expenditure, and metabolic dysfunction.

    Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control
    Article Snippet: .. The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid. ..

    Article Title: Ubc9-Mediated SUMOylation of RPL3, an Unappreciated Mechanism against Hepatocyte Senescence by Repressing the DHX9-p16 Axis.
    Article Snippet: .. Lentiviral Packaging and Transducing (pLKO.1-TRC lentiviral shRNA System): The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1TRC.mKO2, Plasmid #85208) was used for DHX9 knockdown. shRNA targeting sequence for mouse DHX9: (#1: GCCGTTCTCGTGGAAGGTTGG, #2: GCTGCCAGAGACTTTGTTAAC) were cloned into the pLKO.1 plasmid. pLKO.1, pAX.2, and pMD.2G were co-transfected into HEK293T cells at a ratio of 4:3:1 for 48 h. The viral supernatant was collected, purified, and used to transduce AML12 cells in the presence of polybrene (8 μg mL−1) for 24 h. Western blot analysis was used to assess knockdown efficiency, and a short hairpin RNA (shRNA) was used as a negative control. ..

    Plasmid Preparation:

    Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control.
    Article Snippet: .. The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A: (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a: (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1: (GCTACTTTACTCCAACTTATT), human MFN1: (GCTCAAAGTTGTAAATGCTTT), and human MIRO2: (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid. ..


    Article Title: Macrophage PD-1 regulates energy expenditure and metabolic dysfunction under immune checkpoint blockade.
    Article Snippet: In brief Wu et al. identified a moonlighting function of macrophage PD-1 in protecting against high-fat diet-induced obesity and the obesity-associated inflammatory microenvironment by suppressing ER stress-mediated systemic inflammatory responses.. Their findings highlight the critical role of macrophage PD-1 at the intersection of immune checkpoint blockade, energy expenditure, and metabolic dysfunction.

    Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control
    Article Snippet: .. The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid. ..

    Article Title: Ubc9-Mediated SUMOylation of RPL3, an Unappreciated Mechanism against Hepatocyte Senescence by Repressing the DHX9-p16 Axis.
    Article Snippet: .. Lentiviral Packaging and Transducing (pLKO.1-TRC lentiviral shRNA System): The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1TRC.mKO2, Plasmid #85208) was used for DHX9 knockdown. shRNA targeting sequence for mouse DHX9: (#1: GCCGTTCTCGTGGAAGGTTGG, #2: GCTGCCAGAGACTTTGTTAAC) were cloned into the pLKO.1 plasmid. pLKO.1, pAX.2, and pMD.2G were co-transfected into HEK293T cells at a ratio of 4:3:1 for 48 h. The viral supernatant was collected, purified, and used to transduce AML12 cells in the presence of polybrene (8 μg mL−1) for 24 h. Western blot analysis was used to assess knockdown efficiency, and a short hairpin RNA (shRNA) was used as a negative control. ..

    Knockdown:

    Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control.
    Article Snippet: .. The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A: (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a: (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1: (GCTACTTTACTCCAACTTATT), human MFN1: (GCTCAAAGTTGTAAATGCTTT), and human MIRO2: (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid. ..

    Article Title: PTEN regulates RPA1 and protects DNA replication forks
    Article Snippet: pSA, pCMV-tag-2b, pGEX-4T-1 and pfastbac1 were purchased from Addgene. .. Wild-type and mutant PTEN and RPA1 were inserted into these plasmids. pLKO.1-TRC lentiviral shRNA system (Addgene) was used for PTEN and RPA1 knockdown. ..


    Article Title: Macrophage PD-1 regulates energy expenditure and metabolic dysfunction under immune checkpoint blockade.
    Article Snippet: In brief Wu et al. identified a moonlighting function of macrophage PD-1 in protecting against high-fat diet-induced obesity and the obesity-associated inflammatory microenvironment by suppressing ER stress-mediated systemic inflammatory responses.. Their findings highlight the critical role of macrophage PD-1 at the intersection of immune checkpoint blockade, energy expenditure, and metabolic dysfunction.

    Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control
    Article Snippet: .. The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid. ..

    Article Title: Ubc9-Mediated SUMOylation of RPL3, an Unappreciated Mechanism against Hepatocyte Senescence by Repressing the DHX9-p16 Axis.
    Article Snippet: .. Lentiviral Packaging and Transducing (pLKO.1-TRC lentiviral shRNA System): The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1TRC.mKO2, Plasmid #85208) was used for DHX9 knockdown. shRNA targeting sequence for mouse DHX9: (#1: GCCGTTCTCGTGGAAGGTTGG, #2: GCTGCCAGAGACTTTGTTAAC) were cloned into the pLKO.1 plasmid. pLKO.1, pAX.2, and pMD.2G were co-transfected into HEK293T cells at a ratio of 4:3:1 for 48 h. The viral supernatant was collected, purified, and used to transduce AML12 cells in the presence of polybrene (8 μg mL−1) for 24 h. Western blot analysis was used to assess knockdown efficiency, and a short hairpin RNA (shRNA) was used as a negative control. ..

    Sequencing:

    Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control.
    Article Snippet: .. The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A: (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a: (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1: (GCTACTTTACTCCAACTTATT), human MFN1: (GCTCAAAGTTGTAAATGCTTT), and human MIRO2: (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid. ..


    Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control
    Article Snippet: .. The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid. ..

    Article Title: Ubc9-Mediated SUMOylation of RPL3, an Unappreciated Mechanism against Hepatocyte Senescence by Repressing the DHX9-p16 Axis.
    Article Snippet: .. Lentiviral Packaging and Transducing (pLKO.1-TRC lentiviral shRNA System): The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1TRC.mKO2, Plasmid #85208) was used for DHX9 knockdown. shRNA targeting sequence for mouse DHX9: (#1: GCCGTTCTCGTGGAAGGTTGG, #2: GCTGCCAGAGACTTTGTTAAC) were cloned into the pLKO.1 plasmid. pLKO.1, pAX.2, and pMD.2G were co-transfected into HEK293T cells at a ratio of 4:3:1 for 48 h. The viral supernatant was collected, purified, and used to transduce AML12 cells in the presence of polybrene (8 μg mL−1) for 24 h. Western blot analysis was used to assess knockdown efficiency, and a short hairpin RNA (shRNA) was used as a negative control. ..

    Clone Assay:

    Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control.
    Article Snippet: .. The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A: (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a: (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1: (GCTACTTTACTCCAACTTATT), human MFN1: (GCTCAAAGTTGTAAATGCTTT), and human MIRO2: (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid. ..


    Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control
    Article Snippet: .. The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid. ..

    Article Title: Ubc9-Mediated SUMOylation of RPL3, an Unappreciated Mechanism against Hepatocyte Senescence by Repressing the DHX9-p16 Axis.
    Article Snippet: .. Lentiviral Packaging and Transducing (pLKO.1-TRC lentiviral shRNA System): The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1TRC.mKO2, Plasmid #85208) was used for DHX9 knockdown. shRNA targeting sequence for mouse DHX9: (#1: GCCGTTCTCGTGGAAGGTTGG, #2: GCTGCCAGAGACTTTGTTAAC) were cloned into the pLKO.1 plasmid. pLKO.1, pAX.2, and pMD.2G were co-transfected into HEK293T cells at a ratio of 4:3:1 for 48 h. The viral supernatant was collected, purified, and used to transduce AML12 cells in the presence of polybrene (8 μg mL−1) for 24 h. Western blot analysis was used to assess knockdown efficiency, and a short hairpin RNA (shRNA) was used as a negative control. ..

    Mutagenesis:

    Article Title: PTEN regulates RPA1 and protects DNA replication forks
    Article Snippet: pSA, pCMV-tag-2b, pGEX-4T-1 and pfastbac1 were purchased from Addgene. .. Wild-type and mutant PTEN and RPA1 were inserted into these plasmids. pLKO.1-TRC lentiviral shRNA system (Addgene) was used for PTEN and RPA1 knockdown. ..

    Infection:


    Article Title: Macrophage PD-1 regulates energy expenditure and metabolic dysfunction under immune checkpoint blockade.
    Article Snippet: In brief Wu et al. identified a moonlighting function of macrophage PD-1 in protecting against high-fat diet-induced obesity and the obesity-associated inflammatory microenvironment by suppressing ER stress-mediated systemic inflammatory responses.. Their findings highlight the critical role of macrophage PD-1 at the intersection of immune checkpoint blockade, energy expenditure, and metabolic dysfunction.

    Cell Culture:


    Purification:

    Article Title: Ubc9-Mediated SUMOylation of RPL3, an Unappreciated Mechanism against Hepatocyte Senescence by Repressing the DHX9-p16 Axis.
    Article Snippet: .. Lentiviral Packaging and Transducing (pLKO.1-TRC lentiviral shRNA System): The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1TRC.mKO2, Plasmid #85208) was used for DHX9 knockdown. shRNA targeting sequence for mouse DHX9: (#1: GCCGTTCTCGTGGAAGGTTGG, #2: GCTGCCAGAGACTTTGTTAAC) were cloned into the pLKO.1 plasmid. pLKO.1, pAX.2, and pMD.2G were co-transfected into HEK293T cells at a ratio of 4:3:1 for 48 h. The viral supernatant was collected, purified, and used to transduce AML12 cells in the presence of polybrene (8 μg mL−1) for 24 h. Western blot analysis was used to assess knockdown efficiency, and a short hairpin RNA (shRNA) was used as a negative control. ..

    Transduction:

    Article Title: Ubc9-Mediated SUMOylation of RPL3, an Unappreciated Mechanism against Hepatocyte Senescence by Repressing the DHX9-p16 Axis.
    Article Snippet: .. Lentiviral Packaging and Transducing (pLKO.1-TRC lentiviral shRNA System): The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1TRC.mKO2, Plasmid #85208) was used for DHX9 knockdown. shRNA targeting sequence for mouse DHX9: (#1: GCCGTTCTCGTGGAAGGTTGG, #2: GCTGCCAGAGACTTTGTTAAC) were cloned into the pLKO.1 plasmid. pLKO.1, pAX.2, and pMD.2G were co-transfected into HEK293T cells at a ratio of 4:3:1 for 48 h. The viral supernatant was collected, purified, and used to transduce AML12 cells in the presence of polybrene (8 μg mL−1) for 24 h. Western blot analysis was used to assess knockdown efficiency, and a short hairpin RNA (shRNA) was used as a negative control. ..

    Western Blot:

    Article Title: Ubc9-Mediated SUMOylation of RPL3, an Unappreciated Mechanism against Hepatocyte Senescence by Repressing the DHX9-p16 Axis.
    Article Snippet: .. Lentiviral Packaging and Transducing (pLKO.1-TRC lentiviral shRNA System): The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1TRC.mKO2, Plasmid #85208) was used for DHX9 knockdown. shRNA targeting sequence for mouse DHX9: (#1: GCCGTTCTCGTGGAAGGTTGG, #2: GCTGCCAGAGACTTTGTTAAC) were cloned into the pLKO.1 plasmid. pLKO.1, pAX.2, and pMD.2G were co-transfected into HEK293T cells at a ratio of 4:3:1 for 48 h. The viral supernatant was collected, purified, and used to transduce AML12 cells in the presence of polybrene (8 μg mL−1) for 24 h. Western blot analysis was used to assess knockdown efficiency, and a short hairpin RNA (shRNA) was used as a negative control. ..

    Negative Control:

    Article Title: Ubc9-Mediated SUMOylation of RPL3, an Unappreciated Mechanism against Hepatocyte Senescence by Repressing the DHX9-p16 Axis.
    Article Snippet: .. Lentiviral Packaging and Transducing (pLKO.1-TRC lentiviral shRNA System): The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1TRC.mKO2, Plasmid #85208) was used for DHX9 knockdown. shRNA targeting sequence for mouse DHX9: (#1: GCCGTTCTCGTGGAAGGTTGG, #2: GCTGCCAGAGACTTTGTTAAC) were cloned into the pLKO.1 plasmid. pLKO.1, pAX.2, and pMD.2G were co-transfected into HEK293T cells at a ratio of 4:3:1 for 48 h. The viral supernatant was collected, purified, and used to transduce AML12 cells in the presence of polybrene (8 μg mL−1) for 24 h. Western blot analysis was used to assess knockdown efficiency, and a short hairpin RNA (shRNA) was used as a negative control. ..



    Similar Products

    96
    Addgene inc lentiviral vector plko 1 shrna control shctrl
    Lentiviral Vector Plko 1 Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+trc+lentiviral+shrna+system/pLKO%2E1+-+TRC+control+(Plasmid+%2310879)/pm41596422-229-0-6
    Average 96 stars, based on 1 article reviews
    lentiviral vector plko 1 shrna control shctrl - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    93
    Addgene inc plko 1 trc lentiviral shrna system
    Plko 1 Trc Lentiviral Shrna System, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+trc+lentiviral+shrna+system/pLKO%2E1-TRC%2EmKO2+(Plasmid+%2385208)/pm41380676-448-9-16
    Average 93 stars, based on 1 article reviews
    plko 1 trc lentiviral shrna system - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 trc lentiviral vector
    Plko 1 Trc Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+trc+lentiviral+shrna+system/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/bio_rxiv__64898__2025__12__02__691892-201-10-13
    Average 96 stars, based on 1 article reviews
    plko 1 trc lentiviral vector - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results